Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: ptr-miR-22

ptr-miR-22 (MIMAT0002332)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
7.0 new record MIMAT0002332 ptr-miR-22 AAGCUGCCAGUUGAAGAACUGU MI0002633
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree