Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: ppa-miR-181c

ppa-miR-181c (MIMAT0002512)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
7.0 new record MIMAT0002512 ppa-miR-181c AACAUUCAACCUGUCGGUGAGU MI0002814
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree