Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: ola-miR-99

ola-miR-99 (MIMAT0022629)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0022629 ola-miR-99 CAAGCUCGCCUCUGUGGGUCUC MI0019505
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree