Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oha-miR-26-5p

oha-miR-26-5p (MIMAT0036861)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036861 oha-miR-26-5p UUCAAGUAAUCCAGGAUAGGCU MI0031434, MI0031435, MI0031436
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree