Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oha-miR-20b-5p

oha-miR-20b-5p (MIMAT0036805)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036805 oha-miR-20b-5p AAAGUGCUCAUAGUGCAGGUA MI0031400
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree