Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oar-miR-376e-3p

oar-miR-376e-3p (MIMAT0019278)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
17.0 new record MIMAT0019278 oar-miR-376e-3p AACAUAGAGGAAAAUCCACAUU MI0016932
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree