Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oar-miR-29b

oar-miR-29b (MIMAT0030054)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0030054 oar-miR-29b UAGCACCAUUUGAAAUCAGUGU MI0025276
21.0 precursors MIMAT0030054 oar-miR-29b UAGCACCAUUUGAAAUCAGUGU MI0025276, MI0031742
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree