Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oar-miR-26b

oar-miR-26b (MIMAT0030052)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0030052 oar-miR-26b UUCAAGUAAUUCAGGAUAGGU MI0025274
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree