Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: oar-miR-1197-5p

oar-miR-1197-5p (MIMAT0019257)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
17.0 new record MIMAT0019257 oar-miR-1197-5p CCCUUCCUGGUAUUUGAAGACG MI0016922
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree