Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: mml-miR-382-5p

mml-miR-382-5p (MIMAT0006311)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0006311 mml-miR-382 GAAGUUGUUCGUGGUGGAUUCG MI0007730
20.0 miRNA name MIMAT0006311 mml-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG MI0007730
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree