Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: mml-miR-184

mml-miR-184 (MIMAT0006218)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0006218 mml-miR-184 UGGACGGAGAACUGAUAAGGGU MI0007648
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree