Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: hsa-miR-95-5p

hsa-miR-95-5p (MIMAT0026473)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0026473 hsa-miR-95-5p UCAAUAAAUGUCUGUUGAAUU MI0000097
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree