Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: hsa-miR-197-3p

hsa-miR-197-3p (MIMAT0000227)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
1.1 new record MIMAT0000227 hsa-miR-197 UUCACCACCUUCUCCACCCAGC MI0000239
18.0 miRNA name MIMAT0000227 hsa-miR-197-3p UUCACCACCUUCUCCACCCAGC MI0000239
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree