Tracking Information miRBase

1 result for query: hsa-miR-181c-5p

hsa-miR-181c-5p (MIMAT0000258)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
1.2 new record MIMAT0000258 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU MI0000271
18.0 miRNA name MIMAT0000258 hsa-miR-181c-5p AACAUUCAACCUGUCGGUGAGU MI0000271
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree