Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: ggo-miR-26b

ggo-miR-26b (MIMAT0024091)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
19.0 new record MIMAT0024091 ggo-miR-26b UUCAAGUAAUUCAGGAUAGGU MI0020638
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree