Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: eca-miR-197

eca-miR-197 (MIMAT0012959)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
14.0 new record MIMAT0012959 eca-miR-197 UUCACCACCUUCUCCACCCAGC MI0012711
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree