Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: eca-miR-181b

eca-miR-181b (MIMAT0013179)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
14.0 new record MIMAT0013179 eca-miR-181b AACAUUCAUUGCUGUCGGUGGGU MI0012921
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree