Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: cgr-miR-382

cgr-miR-382 (MIMAT0023947)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
19.0 new record MIMAT0023947 cgr-miR-382 GAAGUUGUUCGUGGUGGAUUCG MI0020518
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree