Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: cfa-miR-376b

cfa-miR-376b (MIMAT0009887)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
13.0 new record MIMAT0009887 cfa-miR-376b AUCAUAGAGGAAAAUCCAUGUU MI0010386
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree