Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: cfa-miR-26a

cfa-miR-26a (MIMAT0006595)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0006595 cfa-miR-26a UUCAAGUAAUCCAGGAUAGGCU MI0007990, MI0008058
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree