Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: cfa-miR-188

cfa-miR-188 (MIMAT0009880)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
13.0 new record MIMAT0009880 cfa-miR-188 CAUCCCUUGCAUGGUGGAGGGU MI0010379
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree