Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: bta-miR-29d-5p

bta-miR-29d-5p (MIMAT0026919)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0026919 bta-miR-29d-5p UGACCGAUUUCUCCUGGUGUU MI0009788
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree