Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: bta-miR-26b

bta-miR-26b (MIMAT0003531)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
8.1 new record MIMAT0003531 bta-miR-26b UUCAAGUAAUUCAGGAUAGGUU MI0004745
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree