Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: bta-miR-188

bta-miR-188 (MIMAT0009249)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
13.0 new record MIMAT0009249 bta-miR-188 CAUCCCUUGCAUGGUGGAGGGU MI0009760
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree