Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0036812

oha-miR-204-5p (MIMAT0036812)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036812 oha-miR-204-5p UUCCCUUUGUCAUCCUAUGCCU MI0031404, MI0031405, MI0031413
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree