Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0036780

oha-miR-193-3p (MIMAT0036780)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036780 oha-miR-193-3p AACUGGCCUACAAAGUCCCAGU MI0031387
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree