Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0036659

oha-miR-103b-3p (MIMAT0036659)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036659 oha-miR-103b-3p AGCAGCAUUGUACAGGGCUAUGA MI0031318
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree