Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0036480

tch-miR-103a-3p (MIMAT0036480)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0036480 tch-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA MI0031139, MI0031157
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree