Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0034966

efu-miR-342 (MIMAT0034966)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
21.0 new record MIMAT0034966 efu-miR-342 UCUCACACAGAAAUCGCACCCGUCA MI0028651
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree