Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0028764

mdo-miR-20b-5p (MIMAT0028764)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0028764 mdo-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG MI0023938
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree