Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0027942

mmu-miR-7019-5p (MIMAT0027942)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
20.0 new record MIMAT0027942 mmu-miR-7019-5p AUCUGGGAGGGGCUGUCAGGAGU MI0022868
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree