Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0025478

hsa-miR-6511a-5p (MIMAT0025478)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
19.0 new record MIMAT0025478 hsa-miR-6511a-5p CAGGCAGAAGUGGGGCUGACAGG MI0022223, MI0023564, MI0023565, MI0023566
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree