Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0024125

ggo-miR-338 (MIMAT0024125)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
19.0 new record MIMAT0024125 ggo-miR-338 UCCAGCAUCAGUGAUUUUGUUGA MI0020672
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree