Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0023849

cgr-miR-210-3p (MIMAT0023849)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
19.0 new record MIMAT0023849 cgr-miR-210-3p CUGUGCGUGUGACAGCGGCUGA MI0020458
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree