Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0022838

hsa-miR-1185-1-3p (MIMAT0022838)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0022838 hsa-miR-1185-1-3p AUAUACAGGGGGAGACUCUUAU MI0003844
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree