Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0022833

hsa-miR-365b-5p (MIMAT0022833)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0022833 hsa-miR-365b-5p AGGGACUUUCAGGGGCAGCUGU MI0000769
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree