Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0022691

hsa-miR-197-5p (MIMAT0022691)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0022691 hsa-miR-197-5p CGGGUAGAGAGGGCAGUGGGAGG MI0000239
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree