Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0021809

aca-miR-181a (MIMAT0021809)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0021809 aca-miR-181a AACAUUCAACGCUGUCGGUGAGU MI0018775, MI0018776, MI0018777
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree