Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0019306

oar-miR-382-5p (MIMAT0019306)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
17.0 new record MIMAT0019306 oar-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG MI0016947
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree