Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0019043

hsa-miR-2392 (MIMAT0019043)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
17.0 new record MIMAT0019043 hsa-miR-2392 UAGGAUGGGGGUGAGAGGUG MI0016870
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree