Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0015906

ppy-miR-487b (MIMAT0015906)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
15.0 new record MIMAT0015906 ppy-miR-487b AAUCGUACAGGGUCAUCCACUU MI0014960
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree