Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0015002

hsa-miR-466 (MIMAT0015002)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
15.0 new record MIMAT0015002 hsa-miR-466 AUACACAUACACGCAACACACAU MI0014157
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree