Tracking Information miRBase

1 result for query: MIMAT0014635

tgu-miR-99-3p (MIMAT0014635)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
15.0 new record MIMAT0014635 tgu-miR-99* CAAGCUCGCUUCUAUGGGUCU MI0013734, MI0013735
19.0 miRNA name MIMAT0014635 tgu-miR-99-3p CAAGCUCGCUUCUAUGGGUCU MI0013734, MI0013735
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree