Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0014566

tgu-miR-23-3p (MIMAT0014566)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
15.0 new record MIMAT0014566 tgu-miR-23 AUCACAUUGCCAGGGAUUACC MI0013787
19.0 miRNA name MIMAT0014566 tgu-miR-23-3p AUCACAUUGCCAGGGAUUACC MI0013787
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree