Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0014527

tgu-miR-21-5p (MIMAT0014527)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
15.0 new record MIMAT0014527 tgu-miR-21 UAGCUUAUCAGACUGAUGUUGA MI0013739
19.0 miRNA name MIMAT0014527 tgu-miR-21-5p UAGCUUAUCAGACUGAUGUUGA MI0013739
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree