Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0013127

eca-miR-134 (MIMAT0013127)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
14.0 new record MIMAT0013127 eca-miR-134 UGUGACUGGUUGACCAGAGGGG MI0012877
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree