Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0013029

eca-miR-21 (MIMAT0013029)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
14.0 new record MIMAT0013029 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA MI0012776
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree