Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0012925

eca-miR-138 (MIMAT0012925)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
14.0 new record MIMAT0012925 eca-miR-138 AGCUGGUGUUGUGAAUCAGGCCG MI0012681, MI0012824
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree