Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0006639

cfa-miR-425 (MIMAT0006639)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0006639 cfa-miR-425 AAUGACACGAUCACUCCCGUUGA MI0008038
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree