Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0006240

mml-miR-210-3p (MIMAT0006240)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0006240 mml-miR-210 CUGUGCGUGUGACAGCGGCUGA MI0007670
20.0 miRNA name MIMAT0006240 mml-miR-210-3p CUGUGCGUGUGACAGCGGCUGA MI0007670
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree